View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_high_48 (Length: 237)
Name: NF5595_high_48
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 54070587 - 54070381
Alignment:
| Q |
17 |
cacagacgaagttgttcatcgtcggtcatcagaaaaacagtgagaaattccgtccaattccttaccctctcccctggtaagcgggatgacgcgatttcaa |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54070587 |
cacagacgaagttgttcatcgccggtcatcagaaaaacagtgagaaattccgtccaattccttaccctctcccctggtaagcgggatgacgcgatttcaa |
54070488 |
T |
 |
| Q |
117 |
cacgatttgcctcatcaataaccgcccctgcaacaggctacgcgccacagagacgctattgcacc-tcatcgattgaagttcacaatgaggcatagccat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54070487 |
cacgatttgcctcatcaataaccgcccctgcaacaggctacgcgccacagggacgctattgcaccatcatcgattgaagttcacaatgaggcatagccat |
54070388 |
T |
 |
| Q |
216 |
ggttcat |
222 |
Q |
| |
|
||||||| |
|
|
| T |
54070387 |
ggttcat |
54070381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University