View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_high_49 (Length: 231)
Name: NF5595_high_49
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 30 - 155
Target Start/End: Complemental strand, 19055355 - 19055231
Alignment:
| Q |
30 |
tccatggaatcaagaatttaattggtgatatatcttcatctcttacatgacgtgaaggccactaccacaagaatcacaccacatatttcccactgttatg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19055355 |
tccatggaatcaagaatttaattggtgatatatct-catctcttacatgacgtgaaggccaccaccacaagaatcacaccacatatttcccactgttatg |
19055257 |
T |
 |
| Q |
130 |
gttattaccatcatattttcacccca |
155 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
19055256 |
gttattaccatcatattttcatccca |
19055231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 19055231 - 19055192
Alignment:
| Q |
181 |
aggttactactttcaaaaactcaactattagaattatcta |
220 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
19055231 |
aggttactactttcaaaaactcaattattaggattatcta |
19055192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University