View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5595_high_50 (Length: 231)

Name: NF5595_high_50
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5595_high_50
NF5595_high_50
[»] chr1 (1 HSPs)
chr1 (19-207)||(41448042-41448233)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 41448233 - 41448042
Alignment:
19 taggggtaaaattaaatccctggtatagatttccaatataaccattcaagataattgaatcttaaatcgcaaattatgcacaagtaagcaatcaatgtgg 118  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41448233 taggggtaaaattaaatccctggtatagatttccaatagaaccattcaagataattgaatcttaaatcgcaaattatgcacaagtaagcaatcaatgtgg 41448134  T
119 ttaaatcaa--tctcaatg-ccagtataaaagtttgattgaaattggggaagggagaagaggacaagtgaagttggaagattggattcttgt 207  Q
    |||||||||  |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41448133 ttaaatcaatctctcaatgcccagtataaaagtttgattgaaattggggaagggagaagaggacaagtgaagttggaagattggattcttgt 41448042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University