View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_16 (Length: 437)
Name: NF5595_low_16
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 14 - 429
Target Start/End: Complemental strand, 25645039 - 25644625
Alignment:
| Q |
14 |
cagttaccactagagcagttttgttttcaacgagatgaagatatcaaaaccatctttgatgccactatgaaatattaattagtcactatcttaaattagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25645039 |
cagttaccactagagcagttttgttttcaaggagataaagatatcaaaaccatctttgatgccactatgaaatattaattagtcactatcttaaattagt |
25644940 |
T |
 |
| Q |
114 |
tgtgagcttttgtaatggttgaatgctatatatcttatgagtgatattaatgtagtgaaagttcaatgtagattttgcatgtaattgttgcatactagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25644939 |
tgtgagcttttgtaatggttgaatgctatatatcttatgagtgatattaatgtagtgaaagttcaatgtagattttgcatgtaattgttgcatactagaa |
25644840 |
T |
 |
| Q |
214 |
gtgtctttgtctatcaaaaagcactatattctatgtgccaaaaatgcaacatgtatggtcttggtgattatttgcattgatgtcttatgtagagcaaggt |
313 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25644839 |
gtgtctttgtctatcaaaaagcact-tattctatgtgccaaaaatgcaacatgtatggtcttggtgattatttgcattgatgtcttatgtagagcaaggt |
25644741 |
T |
 |
| Q |
314 |
ttttgaaagagacaacaagaatttgtcttgttttgtgtttttgtaacatcgagggtcaatgtagccagggccctttgatatttgccttcctttcttcact |
413 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
25644740 |
ttttgaaagagacaacaaaaatttgtcttgttttgtgtttttgtaacatcgagggtcaatgtagccagggccgtttgatatttgctttcctttcttcact |
25644641 |
T |
 |
| Q |
414 |
aattttggagtattat |
429 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25644640 |
aattttggagtattat |
25644625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University