View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_32 (Length: 307)
Name: NF5595_low_32
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 13 - 290
Target Start/End: Complemental strand, 19292347 - 19292075
Alignment:
| Q |
13 |
aatattgaaagcttcactaaactctctcttgtctcatgttactaaaattgaaacttattgctcattttagtccctctttagattgaaaattgccctaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19292347 |
aatattgaaagcttcactaaactctctcttgtctcatgttactaaaattgaaacttattgctcattttagtccctctttagattgaaaattgccctaatt |
19292248 |
T |
 |
| Q |
113 |
attgtttaatattatatattcaggaaatcgatcgcaaagcaagagaagattaaatagaaaggcaacctgcatgtcatgtagttactgcctaaagatttgg |
212 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19292247 |
attgtttaatgttatatattcaggaa----atcgcaaagcaagagaagattaaatagaaaggcaacctgcatgtcatgtagttactgcctagagatttgg |
19292152 |
T |
 |
| Q |
213 |
caacatagaatttgcatttaggacatctcctccgtttattattcttagcagccgggcgcgtcaacataccatcttctt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19292151 |
caacatagaatttgcatttaggacatctcctcagtttatt-ttcttagcagccgggcgcgtcaacataccatcttctt |
19292075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University