View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_33 (Length: 302)
Name: NF5595_low_33
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 233
Target Start/End: Complemental strand, 20978820 - 20978588
Alignment:
| Q |
8 |
aagcaaaggacaagtagactactattattattact-------attattgctactagtatctatcaaaaatttgcgtgtgttcagcaatttatagctagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20978820 |
aagcaaaggacaagtagactactattattattatttattagtattattgctaccagtatctatcaagaatttgcgtgtgttcagcaatttatagctagac |
20978721 |
T |
 |
| Q |
101 |
ctgacctgtacaaaaacatctatgggatgaagatgatggagtaatcatcactttaaaatatttcaaccatgtacaaaaacatttcaatttcaactaaatg |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20978720 |
ctgacctgtacaaaaacatttatgggatgaagatgatggagtaatcaacactttaaaatatttcaaccatgtacaaaaacatttcaatttcaactaaatg |
20978621 |
T |
 |
| Q |
201 |
tgtagacactaaattaaagtttacctttgataa |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20978620 |
tgtagacactaaattaaagtttacctttgataa |
20978588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 284
Target Start/End: Complemental strand, 28186905 - 28186862
Alignment:
| Q |
243 |
aagagaaactattaaga--gatttagagattaatgagtttgata |
284 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
28186905 |
aagagaaactattaagaaagatttagagattaatgagttggata |
28186862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University