View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_34 (Length: 296)
Name: NF5595_low_34
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 289
Target Start/End: Original strand, 32391231 - 32391499
Alignment:
| Q |
19 |
cctcgttcctctgatacaacatccgtagctagtaaagtttaatgagtgattgaagtcggcgtctatgttgcatttcacgcaaccttgcagaggtggttct |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32391231 |
cctcgttcctctgatgcaacatccgtagctagtaaagtttaatgagtgattgaagtcggcgtctatgttgcatttcacgcaaccttgcagaggtggttct |
32391330 |
T |
 |
| Q |
119 |
tgaatgtcgctgttgtttattctattactgtgcacagcagattgcacgatgtttgtgttggagaacctttgtgttataaggttccgtaacacaaacagcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32391331 |
tgaatgtcgctgttgtttattctattactgtgcacagcagattgcacgctgtttgtgttggagaacctttgtgttataaggttccgtaacac--acagcg |
32391428 |
T |
 |
| Q |
219 |
tgcaatctgctgtgcacactaacagcacgaacagtgtgaaatgcaacgtgcccaacattgcatactctctg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32391429 |
tgcaatctgctgtgcacactaacagcacgaacaatgtgaaatgcaacgtgcccaacattgcataatctctg |
32391499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 236
Target Start/End: Complemental strand, 32391389 - 32391359
Alignment:
| Q |
206 |
aacacaaacagcgtgcaatctgctgtgcaca |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32391389 |
aacacaaacagcgtgcaatctgctgtgcaca |
32391359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 126
Target Start/End: Original strand, 26160729 - 26160815
Alignment:
| Q |
27 |
ctctgatacaacatccgtagctagtaaagtttaatgagtgattgaagtcggcgtctatgttgcatttcacgcaaccttgcagaggtggttcttgaatgtc |
126 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26160729 |
ctctgatgcaacaaccgtagctagtaaagtttaatgagtgatt-------------atgttgcatttcacgcaaccttgcagaggtggttcctgaatgtc |
26160815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 277
Target Start/End: Original strand, 26160819 - 26160869
Alignment:
| Q |
227 |
gctgtgcacactaacagcacgaacagtgtgaaatgcaacgtgcccaacatt |
277 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
26160819 |
gctgtgcacagtaacagcacgaaccgcgtgaaatgcaacgtgcacaacatt |
26160869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University