View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_35 (Length: 295)
Name: NF5595_low_35
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 283
Target Start/End: Complemental strand, 43578611 - 43578339
Alignment:
| Q |
11 |
cataggtacaagagtttattataatgatcaagattgaggggaacatgcgcttttcgcgcttcgtcgtagaggtttagtgcttgtagaacatcactggttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578611 |
cataggtacaagagtttattataatgatcaagattgaggggaacatgcgcttttcgcgcttcatcgtagaggtttagtgcttgtagaacatcactggttt |
43578512 |
T |
 |
| Q |
111 |
tagaacagttgttgagnnnnnnnngtaaaattccaacgggggattcttgagcagcttttcttctggctttggttgaaagcttgatggggtgagtggttga |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578511 |
tagaacagttgttgagttttttttgtaaaattccaacgggggattcttgagcagcttttcttctggctttggttgaaagcttgatggggtgagtggttga |
43578412 |
T |
 |
| Q |
211 |
ttcagtgttgttttgggaagtgggtgtttgagataaagtgttgttgatggtggtggtagtgaagggaagagtg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578411 |
ttcagtgttgttttgggaagtgggtgtttgagataaagtgttgttgatggtggtggtagtgaagggaagagtg |
43578339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University