View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_38 (Length: 282)
Name: NF5595_low_38
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 59 - 274
Target Start/End: Complemental strand, 26305513 - 26305296
Alignment:
| Q |
59 |
ttctctttctgttcactatgaccataatggttgcaatattaatgagttggtttctttcgtttcaagtcgaagtgtcaaaaacatatgtttagagtcactg |
158 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305513 |
ttctctttctgttcactatgactatgatggttgcgatattaatgagttggtttctttcgtttcaagtcgaagtgtcaaaaacatatgtttagagtcactt |
26305414 |
T |
|
| Q |
159 |
tcaccgagtgaagaacgcgtcgtccattctaattcccttttcgaatgccagtccttaga--aattagttacgaaaaattgcattgcgatatttccttcct |
256 |
Q |
| |
|
| ||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26305413 |
ttaccgagtgaagaacgcgtcttccaatctaattcccttttcgaatgccagttcttagaagaattagttatgaaaaattgcattgcgatatttccttcct |
26305314 |
T |
|
| Q |
257 |
ttgctagtctttcatctc |
274 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26305313 |
ttgctagtctttcatctc |
26305296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 16 - 64
Target Start/End: Complemental strand, 26305713 - 26305665
Alignment:
| Q |
16 |
attctttcttttcttcctgctaaagaggccgttagcacttgtgttctct |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305713 |
attctttcttttcttcctgctaaagaggccgttagcacttgtgttctct |
26305665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University