View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5595_low_45 (Length: 250)

Name: NF5595_low_45
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5595_low_45
NF5595_low_45
[»] chr4 (1 HSPs)
chr4 (17-250)||(31612994-31613227)
[»] chr2 (2 HSPs)
chr2 (58-250)||(34430642-34430834)
chr2 (70-227)||(34418416-34418573)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 250
Target Start/End: Original strand, 31612994 - 31613227
Alignment:
17 acgtagtaaacctcgaaacaaatctttaccttaacgtaatactcaacgcggtagcagagatgccagcgttcatgataacagcaatcttgttggataagtt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||||    
31612994 acgtagtaaacctcgaaacaaatctttaccttaacgtaatactcaacgcagtggcggagatgccagcgttcatgataacagcaatcttgttggataagtt 31613093  T
117 tgggaggaaaccattaacaatagggacattatggttcagtggannnnnnngttttgtggggagtttgatgagaaataagggggtgtggaaaggaatgaaa 216  Q
    ||||||||| |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||    
31613094 tgggaggaagccattaacaatagggacattatggttcagtggattcttttgttttgtggggagtttgatgagaaataagggggtgtggaaaggaatgaaa 31613193  T
217 atggtgtgtggaattttgggaatatttgggatgg 250  Q
    ||||||||||||||||||||||||||||||||||    
31613194 atggtgtgtggaattttgggaatatttgggatgg 31613227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 58 - 250
Target Start/End: Complemental strand, 34430834 - 34430642
Alignment:
58 ctcaacgcggtagcagagatgccagcgttcatgataacagcaatcttgttggataagtttgggaggaaaccattaacaatagggacattatggttcagtg 157  Q
    ||||| ||||||||||| ||||| |||||   |||||| ||  | |||||||||| |||||||||||| ||||| |||||||||||| | ||||| ||||    
34430834 ctcaatgcggtagcagaaatgccggcgtttgcgataacggcggtgttgttggataggtttgggaggaagccattgacaatagggacaatgtggtttagtg 34430735  T
158 gannnnnnngttttgtggggagtttgatgagaaataagggggtgtggaaaggaatgaaaatggtgtgtggaattttgggaatatttgggatgg 250  Q
    ||       ||||  |||||||||||||||| |||   ||||||||||||| ||| |||||||| |||||| ||||||| |||||||| ||||    
34430734 gattcttttgtttgatggggagtttgatgagtaatgtaggggtgtggaaagtaattaaaatggtttgtggagttttggggatatttggaatgg 34430642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 70 - 227
Target Start/End: Complemental strand, 34418573 - 34418416
Alignment:
70 gcagagatgccagcgttcatgataacagcaatcttgttggataagtttgggaggaaaccattaacaatagggacattatggttcagtggannnnnnngtt 169  Q
    |||||||||||||| |||| |||||| ||| | || ||||||| |||||| ||||||||||| |||||||||||| | ||||| ||||||       |||    
34418573 gcagagatgccagcattcacgataaccgcagtgttattggataggtttggaaggaaaccattgacaatagggacaatgtggtttagtggattcttttgtt 34418474  T
170 ttgtggggagtttgatgagaaataagggggtgtggaaaggaatgaaaatggtgtgtgg 227  Q
    |  |||||||||| ||| | |||   ||||||||||||| ||| ||| ||||||||||    
34418473 tgctggggagttttatgggtaatgtaggggtgtggaaagtaattaaattggtgtgtgg 34418416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University