View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_47 (Length: 240)
Name: NF5595_low_47
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 3 - 225
Target Start/End: Original strand, 7144209 - 7144430
Alignment:
| Q |
3 |
agatgaaccacatgagggatggctaaattccaaaggcaggttatgatctatttccgaatatgattgttagttgtgacatgagagacaatagaacatgaaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7144209 |
agatgaaccacatgagggatggctaaattccaaaggcaggttatgatctatttccgaatatgattgttagttgtgacatgagagacaatagaacatgaaa |
7144308 |
T |
|
| Q |
103 |
aatatgggtgacttgtgacnnnnnnnnnnnataagatttattgaaatgattactcaaaacaatacattgaaaggaagtattggatttagccaccaagata |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7144309 |
aatatgggtgacttgtgac-ttttttttttataagatttattgaaatgagtactcaaaacaatacattgaaaggaagtattggatttagccaccaagata |
7144407 |
T |
|
| Q |
203 |
aggaaagaagatttttactacta |
225 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7144408 |
aggaaagaagatttttactacta |
7144430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University