View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_52 (Length: 228)
Name: NF5595_low_52
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 209
Target Start/End: Complemental strand, 44347172 - 44346975
Alignment:
| Q |
12 |
cgaagaatatgtgtataattatcatgtaataaaaggttatttgtttcgaaactatttaataaaaggatcccaacaaaggataatctaagtcgtcgtggtg |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44347172 |
cgaaaaatatgtgtataattatcatgtaataaaaggttatttgttttgaaactatttaataaaaggatcccaacaaaggataatctaagtcgtcgtggtg |
44347073 |
T |
|
| Q |
112 |
tggggcttctgattcgttacattgttcgggaggacatggtaaggaggaggaaacaattaatcatctatttgttggttgtgacttctttggtagcgttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44347072 |
tggggcttctgattcgttacattgttcgggaggacatggtaaggaggaggaaacaattaatcatctatttgttggttgtgacttctttggtagtgttg |
44346975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 36281727 - 36281683
Alignment:
| Q |
159 |
aggaaacaattaatcatctatttgttggttgtgacttctttggta |
203 |
Q |
| |
|
||||||||||||||||||||||| |||| | |||||||||||||| |
|
|
| T |
36281727 |
aggaaacaattaatcatctatttcttggatatgacttctttggta |
36281683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University