View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5595_low_53 (Length: 227)
Name: NF5595_low_53
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5595_low_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 15652144 - 15652211
Alignment:
| Q |
16 |
atgaacaaggacaaactgtatcactcattggaaatagttataatagataataaggttgtttgacacca |
83 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15652144 |
atgaacaaggacaaactctctcactcattggaaatagttataatagataataaggttgtttgacacca |
15652211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 612427 - 612494
Alignment:
| Q |
16 |
atgaacaaggacaaactgtatcactcattggaaatagttataatagataataaggttgtttgacacca |
83 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
612427 |
atgaacaaggaaaaactgtctcactcattgcaaatagttataatagataataaagttgtttgacacca |
612494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 171 - 209
Target Start/End: Original strand, 612582 - 612620
Alignment:
| Q |
171 |
ctcaatcgaatatgataccgttgaattcgtttatgatgt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
612582 |
ctcaatcgaatatgataccgttgaattcgtttatgatgt |
612620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University