View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5595_low_53 (Length: 227)

Name: NF5595_low_53
Description: NF5595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5595_low_53
NF5595_low_53
[»] chr6 (1 HSPs)
chr6 (16-83)||(15652144-15652211)
[»] chr4 (2 HSPs)
chr4 (16-83)||(612427-612494)
chr4 (171-209)||(612582-612620)


Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 15652144 - 15652211
Alignment:
16 atgaacaaggacaaactgtatcactcattggaaatagttataatagataataaggttgtttgacacca 83  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||    
15652144 atgaacaaggacaaactctctcactcattggaaatagttataatagataataaggttgtttgacacca 15652211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 83
Target Start/End: Original strand, 612427 - 612494
Alignment:
16 atgaacaaggacaaactgtatcactcattggaaatagttataatagataataaggttgtttgacacca 83  Q
    ||||||||||| ||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||    
612427 atgaacaaggaaaaactgtctcactcattgcaaatagttataatagataataaagttgtttgacacca 612494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 171 - 209
Target Start/End: Original strand, 612582 - 612620
Alignment:
171 ctcaatcgaatatgataccgttgaattcgtttatgatgt 209  Q
    |||||||||||||||||||||||||||||||||||||||    
612582 ctcaatcgaatatgataccgttgaattcgtttatgatgt 612620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University