View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5596-Insertion-1 (Length: 127)
Name: NF5596-Insertion-1
Description: NF5596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5596-Insertion-1 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 7e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 7e-53
Query Start/End: Original strand, 15 - 127
Target Start/End: Complemental strand, 4446856 - 4446744
Alignment:
| Q |
15 |
cctccactttactaccaaccaatgctcaaagaatcaatcaaccgtttcttaaccgaatactgcaacggtgctactaatttcaccgatttcacctcaatct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4446856 |
cctccactttactaccaaccaatgctcaaagaatcaatcaaccgtttcttaaccgactaccgcaacggtgctactaatttcaccgatttcacctcaatct |
4446757 |
T |
 |
| Q |
115 |
tctcccgcgcaat |
127 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4446756 |
tctcccgcgcaat |
4446744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University