View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5597-Insertion-6 (Length: 288)
Name: NF5597-Insertion-6
Description: NF5597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5597-Insertion-6 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 94 - 288
Target Start/End: Original strand, 49919117 - 49919311
Alignment:
| Q |
94 |
ttcctataaagaattattcaatcatcactctcttaaactaactctaaccctttgacagagaaaagtgctagaagcacgtttcctcacctaattaacttcc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49919117 |
ttcctataaagaattattcaatcatcactctcttaaactaactctaaccctttgacagagaaaagtgctagaagcacgtttcctcacctaattaacttcc |
49919216 |
T |
 |
| Q |
194 |
gaaccgccaggttaactggttttcgccgtctcttctcggttgtaggagccttcttttttaatcatggcatagccaacctcaaaactcaggtgatg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49919217 |
gaaccgccaggttaactggttttcgccgtctcttctcggttgtaggagccttcttttttaatcatggcatagccaacctcaaaactcaggtgatg |
49919311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 49919037 - 49919091
Alignment:
| Q |
10 |
acggtgatgttgatggttacatctccatatgcggctacggttctctcctctccgg |
64 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49919037 |
acggtgacgttgatggttacatctccatatgcggctacggttctctcctctccgg |
49919091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University