View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5597_low_11 (Length: 249)
Name: NF5597_low_11
Description: NF5597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5597_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 26475812 - 26476041
Alignment:
| Q |
1 |
ggttccgatgaaaaagttaagtaacttacgccatggaggaggacttgtaatgcaaaaagaaacatttggtaattgatctttaaccggatgtggaagaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26475812 |
ggttccgatgaaaaagttaagtaacttacgccatggaggaggacttgtaatgcaaaaagaaacatttggtaattgatctttaaccggatgtggaagaagt |
26475911 |
T |
 |
| Q |
101 |
tcatctagctttggttgtggtgcagctccacctcctgccattcttcttattatgaacttaacaatgcaaccaaaactcaaacttctcagaacccaaaatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26475912 |
tcatctagctttggttgtggtgcagctccacctcctgccattcttcttattatgaacttaacaatgcaaccaaaactcaaacttctcagaacccaaaatt |
26476011 |
T |
 |
| Q |
201 |
gcaaaatcaaagcttcactagatgagtatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26476012 |
gcaaaatcaaagcttcactagatgagtatt |
26476041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 78
Target Start/End: Complemental strand, 35263976 - 35263921
Alignment:
| Q |
23 |
aacttacgccatggaggaggacttgtaatgcaaaaagaaacatttggtaattgatc |
78 |
Q |
| |
|
|||| |||||||||||||||||| |||||||| |||||| |||||||| |||||| |
|
|
| T |
35263976 |
aactaacgccatggaggaggactagtaatgcagtaagaaatatttggtagttgatc |
35263921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University