View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5597_low_7 (Length: 293)
Name: NF5597_low_7
Description: NF5597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5597_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 18 - 156
Target Start/End: Complemental strand, 36669725 - 36669587
Alignment:
| Q |
18 |
actaatagcattaatatttctctacaaaacggagctcgagcttatgatctcacttgaaaaatctaattcctataaccatatatattttagaatctttaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36669725 |
actaatagcattaatatttctctacaaaacggagctcaagcttatgatctcacttgaaaaatctaataactataaccatatatattttagaatctttaac |
36669626 |
T |
 |
| Q |
118 |
cgagtatagttttcatagttcaggagagatatctcaaag |
156 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36669625 |
cgagtataactttcatagttcaggagagatatctcaaag |
36669587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 241 - 284
Target Start/End: Complemental strand, 36669500 - 36669457
Alignment:
| Q |
241 |
ttaatgtattgacccatcatacactgatcctatgtgatgatatt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36669500 |
ttaatgtattgacccatcatacactgatcctatgtgatgatatt |
36669457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University