View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5598_high_16 (Length: 259)
Name: NF5598_high_16
Description: NF5598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5598_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 8 - 155
Target Start/End: Complemental strand, 39232045 - 39231897
Alignment:
| Q |
8 |
cgaagaatatttactgagaaaaat-taatttttaactttttatattgtgaaattaatttcttaacttggaaaacaaaacatagtcaattgaaatttgaaa |
106 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39232045 |
cgaataatatttactgagaaaaaaataatttttaactttttatattgtgaaattaatttcttaacttggaaaacaaaacacagtcaattgaaatttgaaa |
39231946 |
T |
|
| Q |
107 |
ggttgtattcattcattcaacaaactacaattttcattgccgtcgaatg |
155 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||||||||||| ||||||| |
|
|
| T |
39231945 |
ggttgaattcattcattgaacaaattacaattttcattgccttcgaatg |
39231897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 218 - 259
Target Start/End: Complemental strand, 39231834 - 39231793
Alignment:
| Q |
218 |
ggagagtaaaatagatgatgataaatacccaaaacaccataa |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39231834 |
ggagagtaaaatggatgatgataaatacccaaaacaccataa |
39231793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University