View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5598_high_17 (Length: 259)
Name: NF5598_high_17
Description: NF5598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5598_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 3 - 207
Target Start/End: Complemental strand, 43135106 - 43134899
Alignment:
| Q |
3 |
agcaaacttattatgttattgtgtgacataataatctttgctggtaaacatttatagatggacnnnnnnnattgacgttttataattttagagatgtatt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43135106 |
agcaaacttattatgttattgtgtgacataataatccttgctggtaaacatttatagatggactttttttattgacgttttataattttagagatgtatt |
43135007 |
T |
|
| Q |
103 |
tat---caattcgaaaataagaaagtcagttatgaccgatgattataatttcaatgactaatttacttattcacttaacgataagtcattaatcgtttgt |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43135006 |
tattatcaattcgaaaataagaaagtcagttatgaccgatgattataatttcaatgactaatttacttattcacttaacgataagtcattaatcgtttgt |
43134907 |
T |
|
| Q |
200 |
acatggta |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
43134906 |
acatggta |
43134899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 43134781 - 43134741
Alignment:
| Q |
174 |
ttaacgataagtcattaatcgtttgtacatggtatatagta |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43134781 |
ttaacgataagtcattaattgtttgtacatggtatatagta |
43134741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University