View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5598_low_15 (Length: 276)
Name: NF5598_low_15
Description: NF5598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5598_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 19 - 153
Target Start/End: Original strand, 10067882 - 10068016
Alignment:
| Q |
19 |
aacgttccatgagttcgccgccgaggatgccgtcggggaagccgtggaaatgctcgacgtcggttgtggtggtgagttggcctcccggagcgatgtcgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10067882 |
aacgttccatgagttcgccgccgaggatgccgtcggggaagccggggaaattctcgacgtcggttgtagtggtgagttggcctcccggagcgatgtcgtt |
10067981 |
T |
 |
| Q |
119 |
ggccatccatccttcgaagaggattggtttgagtt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10067982 |
ggccatccatccttcgaagaggattggtttgagtt |
10068016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 226
Target Start/End: Original strand, 10068059 - 10068089
Alignment:
| Q |
196 |
cgctgccgatgatgcagagcttggttttaac |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10068059 |
cgctgccgatgatgcagagcttggttttaac |
10068089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University