View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5598_low_15 (Length: 276)

Name: NF5598_low_15
Description: NF5598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5598_low_15
NF5598_low_15
[»] chr5 (2 HSPs)
chr5 (19-153)||(10067882-10068016)
chr5 (196-226)||(10068059-10068089)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 19 - 153
Target Start/End: Original strand, 10067882 - 10068016
Alignment:
19 aacgttccatgagttcgccgccgaggatgccgtcggggaagccgtggaaatgctcgacgtcggttgtggtggtgagttggcctcccggagcgatgtcgtt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||||||||    
10067882 aacgttccatgagttcgccgccgaggatgccgtcggggaagccggggaaattctcgacgtcggttgtagtggtgagttggcctcccggagcgatgtcgtt 10067981  T
119 ggccatccatccttcgaagaggattggtttgagtt 153  Q
    |||||||||||||||||||||||||||||||||||    
10067982 ggccatccatccttcgaagaggattggtttgagtt 10068016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 196 - 226
Target Start/End: Original strand, 10068059 - 10068089
Alignment:
196 cgctgccgatgatgcagagcttggttttaac 226  Q
    |||||||||||||||||||||||||||||||    
10068059 cgctgccgatgatgcagagcttggttttaac 10068089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University