View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5598_low_2 (Length: 485)
Name: NF5598_low_2
Description: NF5598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5598_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 440; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 440; E-Value: 0
Query Start/End: Original strand, 5 - 464
Target Start/End: Original strand, 34897812 - 34898271
Alignment:
| Q |
5 |
agcataggacggcacaagggtggcgattaaaatcctgcaaacggtttccacttccatcccattgcacaagtaagccatttgtacatccactccaaactat |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34897812 |
agcattggacggcacaagggtggcgattaaaatcctgcaaacggtttccacttccatcccattgcacaagtaagccatttgtacatccactccaaattat |
34897911 |
T |
 |
| Q |
105 |
cccatcgtttgtttgcacaagggcttccgttcttttagtatcatcaacaaatgctccagctcccttagttgcaactcgacggacagcatctgcagctccc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34897912 |
cccatcgtttgtttgcacaagggcttccgttcttttagtatcatcaacaaatgctccagctcccttggttgcaactcgacggacagcatctgcagctccc |
34898011 |
T |
 |
| Q |
205 |
atgattgcattacgtgacctctgcagaaagctagtactctgggacttttccttttttgagttggaaacaaactttaccttcatttcgtcttctactgctt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34898012 |
atgattgcattacgtgacctctgcagaaagctagtactctgggacttttccttttttgagttggaaacaaacttcaccttcatttcgtcttctactgctt |
34898111 |
T |
 |
| Q |
305 |
gatcctgctgcacggatgacatgtcaactcgattttctgcttgaccatcgatgttaaatactttcagaaggtcctttgtacgcgcatccctataaaatta |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34898112 |
gatcctgctgcacggatgacatgtcaactcgattttctgcttgaccatcgatgttaaatactttcagaaggtcctttgtacgcgcatccctataaaatta |
34898211 |
T |
 |
| Q |
405 |
aagattccaagttattcaaattcatttagatttgatgcgagtagaaggaaacacaaacac |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34898212 |
aagattccaagttattcaaattcatttagagttgatgcgagtagaaggaaacacaaacac |
34898271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University