View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5598_low_21 (Length: 250)
Name: NF5598_low_21
Description: NF5598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5598_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 29 - 137
Target Start/End: Original strand, 45224639 - 45224747
Alignment:
| Q |
29 |
tatatctaggaggagaagagtatgatgtaaaatatctaggaggagaagtgtattatgtgaaatatctaggaagaggagagtattatttaaaaattttaca |
128 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || | |
|
|
| T |
45224639 |
tatatctaggaggagaagagtattatgtaaaatatctaggaggagaagtgtattatgtgaaatatctaggaagaggagagtattatttaaaatttatata |
45224738 |
T |
|
| Q |
129 |
taatcaaat |
137 |
Q |
| |
|
||| ||||| |
|
|
| T |
45224739 |
taaacaaat |
45224747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 45224762 - 45224866
Alignment:
| Q |
122 |
ttttacataatcaaatgtgcaagtgtatttgctttttcgatagtcttccctcaccgtcactctcagtcacttctagaccaccgcgtcagcaatgtcgaga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45224762 |
ttttacataatcaaatgtgcaagtgtatttgctttttcgatagtcttccctcacc----------gtcacttctagaccaccgcgtcagcaatgtcgaga |
45224851 |
T |
|
| Q |
222 |
ttaaggttgtgtttg |
236 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
45224852 |
ttaaggctgtgtttg |
45224866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University