View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5598_low_24 (Length: 241)
Name: NF5598_low_24
Description: NF5598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5598_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 39231528 - 39231305
Alignment:
| Q |
1 |
ccaaaacataatgccccatactctcacttgcttccaacaaattctctttacacaaaaactcattcccacaaacttgttcaacttcaccagaaaaatcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231528 |
ccaaaacataatgccccatactctcacttgcttccaacaaattctctttacacaaaaactcattcccacaaacttgttcaacttcaccagaaaaatcatg |
39231429 |
T |
|
| Q |
101 |
caaaaacacatgagtctttgggttaccacctttcttacttctagccaacaccccggctgtaaatatcgccgacattctcccgggagcttccggccaatcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231428 |
caaaaacacatgagtctttgggttaccacctttcttacttctagccaacaccccggcggtaaatatcgccgacattctcccgggagcttccggccaatcc |
39231329 |
T |
|
| Q |
201 |
ccacgaggcccgtcaaccaatatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39231328 |
ccacgaggcccgtcaaccaatatt |
39231305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 193
Target Start/End: Original strand, 33371810 - 33371872
Alignment:
| Q |
131 |
tttcttacttctagccaacaccccggctgtaaatatcgccgacattctcccgggagcttccgg |
193 |
Q |
| |
|
|||||| || ||||||||||| | |||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
33371810 |
tttcttgctcctagccaacactgctgctgtaaagatcgccgacattctccccggagctgccgg |
33371872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University