View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5598_low_26 (Length: 222)
Name: NF5598_low_26
Description: NF5598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5598_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 42 - 206
Target Start/End: Original strand, 38360452 - 38360616
Alignment:
| Q |
42 |
cagtgaatttcaattcaaaggctttgatacacaaattgaatttagaaaatttaaaagaacagacaaaaaatactctgtttttggtatatatgtgattttg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38360452 |
cagtgaatttcaattcaaaggctttgatacacaaattgaatttagaaaatttaaaagaacaaacaaaaaatactctgtttttggtatatatgtgattttg |
38360551 |
T |
 |
| Q |
142 |
caaggtgaaataaaaacataagcatgtgattacaactttacaagagagaggcgaaagtaactaac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38360552 |
caaggtgaaataaaaacataagcatgtgattacaactttacaagagagaggggaaagtaactaac |
38360616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University