View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5600-Insertion-1 (Length: 291)
Name: NF5600-Insertion-1
Description: NF5600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5600-Insertion-1 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 8 - 291
Target Start/End: Complemental strand, 39194975 - 39194692
Alignment:
| Q |
8 |
taaatgagagcagtatgtggaagaaaagatgccaatgaaatggaaagtggtatctttgctttctgagcgaggaccagctgtggagtcccatgaagcagag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39194975 |
taaatgagagcagtatgtggaagaaaagatgccaatgaaatggaaagtggtatctttgctttctgagcgaggaccagctgtggagtcccatgaagcagag |
39194876 |
T |
 |
| Q |
108 |
tcaagatgcagctttgtacagaaattaagatagatgaccctaaaaagttaaggcatgaaagttgaaagggatagcaaccacaaacaaacgtagtataaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39194875 |
tcaagatgcagctttgtacagaaattaagatagatgaccctaaaaagttaaggcatgaaagttgaaagagatagcaaccacaaacaaacgtagtataaag |
39194776 |
T |
 |
| Q |
208 |
gcaagaaccagcttttgggccctcactcacatgttcgttaaaatacatacagactttccaaagtttatatatgtaaccctcttg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39194775 |
gcaagaaccagcttttgggccctcactcacatgttcgttaaaatacatacagactttccaaagtttatatatgtaaccctcttg |
39194692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University