View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5600_low_11 (Length: 294)
Name: NF5600_low_11
Description: NF5600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5600_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 281
Target Start/End: Complemental strand, 45301546 - 45301283
Alignment:
| Q |
19 |
aaaaatgatataataatttgtattaagatcttaaatatactaacatgatatgtaacnnnnnnnnnnntacaaacatgataccaacaaagtataatctggt |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45301546 |
aaaaatgaaataataatttgtattaagatcttaaacatactaacatgatatgtaacaaaaaaaaaa-tacaaacatgataccaacaaagtataatctggt |
45301448 |
T |
 |
| Q |
119 |
tcttcgaggattggttccaacatgttcttggagtgtgacttttacagcaatcgttggcatctaattcttggttggtggtgatttacactgctcaacctga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45301447 |
tcttcgaggattggttccaacatgttcttggagtgtgacttttacagcaatcgttggcatctaattcttggttggtggtgatttacactgctcaacctga |
45301348 |
T |
 |
| Q |
219 |
cggtatcggt--tcacgcgcttcagtttggtggctcacatgtcttcaggaaggaaattcgtggtt |
281 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
45301347 |
cggtatcggttctcacgcgcttcagtttggtggctcacatgtcttaaggaaggaaatccgtggtt |
45301283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University