View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5601_high_34 (Length: 207)
Name: NF5601_high_34
Description: NF5601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5601_high_34 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 8289960 - 8289758
Alignment:
| Q |
1 |
atcacataaatcatgatagtattaaatgccagccgagaatttttcgaagnnnnnnnnnnnnccctagcccaccaaactgcaaaacaatcaacattagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8289960 |
atcacataaatcatgatagtattaaatgccagccaagaatttttcgaagaaaaaaaaa---ccctagcccaccaaactgcaaaacaatcaacatcagaag |
8289864 |
T |
 |
| Q |
101 |
tagccgttgagatatctaaccaaccggaaatcaaagatcaaagtctgtcatgcaaatcacatttagtaaataaattatctatatcttcaaagcgcccaca |
200 |
Q |
| |
|
| |||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
8289863 |
tggccgttgagaaatctaaccaaccgaaaatcaaagatcaaagtctctcatgcaaatcacatttagt-aataaattatctatatcttcaaagcacccaca |
8289765 |
T |
 |
| Q |
201 |
atctgcc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
8289764 |
atctgcc |
8289758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University