View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5601_low_13 (Length: 394)
Name: NF5601_low_13
Description: NF5601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5601_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 383
Target Start/End: Complemental strand, 15702939 - 15702574
Alignment:
| Q |
18 |
cctttaaggggtgcatatgaaatatggcatcttctatttctttatctgtgaatgcagctccacaccggtctgcgtgtttcggagttaactttcctttgac |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||| |||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
15702939 |
cctttaaggggtgcatctgaaatatggcatcttctaattctttatctgtgaatacagctcaacaccgatctgcgtgttccggagttaactttcctttgat |
15702840 |
T |
 |
| Q |
118 |
agtttcacattcttcttcaatatttgatggagaggaagtagtgaaaatatcagagaaataagaggttaagagtctttctagatggtcatcacctttccac |
217 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15702839 |
agtttcacatacttcttcaatattggatggagaggaagtagtgaaaatatcagagaaataagaggttaagagtctttctagatggtcatcacctttccac |
15702740 |
T |
 |
| Q |
218 |
cacactccgtcgacatctttcagtttcttaattgcatttgctttcctcctctggtcggccttgctatggaaaatttttgtatttctatcaccatccttca |
317 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15702739 |
cacactccgaagacatctttcagtttcttaattgcatttgttttcctcctctggtcggccttgctatggaaaatttttgtatttctatccccatccttca |
15702640 |
T |
 |
| Q |
318 |
accatactgccatacttctctgcctccacaaaacctcatctgttctcaacaggttgtctctctgct |
383 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15702639 |
accatactgccctactcctctgcctccacaaaaccttatctgttctcaacaggttgtctctctgct |
15702574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 315
Target Start/End: Complemental strand, 23378379 - 23378347
Alignment:
| Q |
283 |
atggaaaatttttgtatttctatcaccatcctt |
315 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
23378379 |
atggaaattttttgtatttctatcaccatcctt |
23378347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University