View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5601_low_24 (Length: 287)

Name: NF5601_low_24
Description: NF5601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5601_low_24
NF5601_low_24
[»] chr8 (4 HSPs)
chr8 (14-269)||(9942658-9942913)
chr8 (94-214)||(35620004-35620123)
chr8 (103-218)||(19996571-19996686)
chr8 (103-218)||(15760735-15760850)
[»] chr1 (4 HSPs)
chr1 (99-218)||(18008469-18008588)
chr1 (102-260)||(40336472-40336630)
chr1 (190-229)||(30618430-30618469)
chr1 (103-246)||(52780059-52780202)
[»] chr7 (1 HSPs)
chr7 (93-257)||(24508478-24508642)
[»] scaffold0015 (1 HSPs)
scaffold0015 (103-242)||(29900-30039)
[»] chr2 (5 HSPs)
chr2 (91-208)||(28154200-28154317)
chr2 (99-155)||(13133064-13133120)
chr2 (94-218)||(13486811-13486935)
chr2 (94-157)||(31482359-31482422)
chr2 (100-157)||(34977624-34977681)
[»] chr5 (2 HSPs)
chr5 (103-218)||(18482403-18482518)
chr5 (99-155)||(26498345-26498401)
[»] chr3 (6 HSPs)
chr3 (92-218)||(12996228-12996354)
chr3 (99-155)||(8838504-8838560)
chr3 (99-155)||(55312440-55312496)
chr3 (103-217)||(12298808-12298922)
chr3 (118-154)||(22444197-22444233)
chr3 (108-204)||(23369868-23369964)
[»] scaffold0012 (1 HSPs)
scaffold0012 (91-182)||(176056-176147)
[»] scaffold0329 (1 HSPs)
scaffold0329 (103-246)||(13388-13531)
[»] chr4 (3 HSPs)
chr4 (94-157)||(19799172-19799235)
chr4 (128-200)||(5381943-5382015)
chr4 (99-155)||(14041295-14041351)


Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 14 - 269
Target Start/End: Original strand, 9942658 - 9942913
Alignment:
14 tactacacttattgtcctacattcagataacttgtactgcaagttattgatcaaaactatctctcttagtcttatttagctcatggtgtaatatcccccc 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9942658 tactacacttattgtcctacattcagataacttgtactgcaagttattgatcaaaactatctctcttagtcttatttagctcatggtgtaatatcccccc 9942757  T
114 acatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagtctgcaacttga 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9942758 acatgttggaggctggtagatatctatcatccccaacttggatagcaaattgttgaatggttgtggaagcaaagctttggtgaaaaagtctgcaacttga 9942857  T
214 tctttggatgagactgatagtaacttgaggatgttggcttgaagtttctctcttac 269  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9942858 tctttggatgagactgatagtaacttgaggatgttggcttgaagtttctctcttac 9942913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 94 - 214
Target Start/End: Complemental strand, 35620123 - 35620004
Alignment:
94 tcatggtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttgg 193  Q
    |||||||| |||| ||||||||| |||| ||| ||||||||||||| |||||||||||||||||| |||  |||| ||||||| |||||||||| |||||    
35620123 tcatggtgcaata-ccccccacaagttgaaggttggtagatatctaacatccccaacttggatagtaaaaggttgcatggttgaggaagcaaagatttgg 35620025  T
194 tgaaaaagtctgcaacttgat 214  Q
    ||||||| || || |||||||    
35620024 tgaaaaaatcagctacttgat 35620004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 103 - 218
Target Start/End: Complemental strand, 19996686 - 19996571
Alignment:
103 aatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagt 202  Q
    |||||||||||||| |||||||| ||||| ||||||| ||||||||||||||||||||     ||||||||||| |||||||| | ||| || ||||| |    
19996686 aatatccccccacaagttggagggtggtatatatctaacatccccaacttggatagaagtaaattgaatggttgaggaagcaatgattttgtaaaaaaat 19996587  T
203 ctgcaacttgatcttt 218  Q
    |||| |||||||||||    
19996586 ctgctacttgatcttt 19996571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 103 - 218
Target Start/End: Complemental strand, 15760850 - 15760735
Alignment:
103 aatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagt 202  Q
    |||||||||||||| ||| |||| ||||||||||||| ||| ||||||||||||||||     || || ||||| ||||| || | ||| |||||||| |    
15760850 aatatccccccacaagttcgaggatggtagatatctaacattcccaacttggatagaagcggattaaaaggttgaggaagtaaggattttgtgaaaaaat 15760751  T
203 ctgcaacttgatcttt 218  Q
    |||| |||||||||||    
15760750 ctgccacttgatcttt 15760735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 64; Significance: 5e-28; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 99 - 218
Target Start/End: Complemental strand, 18008588 - 18008469
Alignment:
99 gtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaa 198  Q
    |||||||||||||| ||| ||||||||||||||||||| ||||||| || |||||||||  |||||||||||||||||| |||||||||| || || ||     
18008588 gtgtaatatccccctacaagttggaggctggtagatatatatcatctccgacttggataacaaattgttgaatggttgtcgaagcaaagccttagtaaag 18008489  T
199 aagtctgcaacttgatcttt 218  Q
    |||||||||| ||| |||||    
18008488 aagtctgcaatttggtcttt 18008469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 260
Target Start/End: Complemental strand, 40336630 - 40336472
Alignment:
102 taatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaag 201  Q
    ||||| ||||||||| |||||||| || || || ||||||||| |||||||||| |  | ||||||||||||||| ||||| | |||||| ||||| |||    
40336630 taatagccccccacaagttggagggtgatatatgtctatcatctccaacttggacaatagattgttgaatggttgaggaagaagagctttagtgaagaag 40336531  T
202 tctgcaacttgatctttggatgagactgatagtaacttgaggatgttggcttgaagttt 260  Q
    |   ||| ||| |||||||| |||| ||  || || ||||| |||||||| ||||||||    
40336530 ttaacaatttgctctttggaggagattggcagaaatttgagaatgttggcctgaagttt 40336472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 190 - 229
Target Start/End: Original strand, 30618430 - 30618469
Alignment:
190 ttggtgaaaaagtctgcaacttgatctttggatgagactg 229  Q
    |||||||||||||||||||||||||||||||| |||||||    
30618430 ttggtgaaaaagtctgcaacttgatctttggaggagactg 30618469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 103 - 246
Target Start/End: Complemental strand, 52780202 - 52780059
Alignment:
103 aatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagt 202  Q
    |||| ||||||||| | |||||| ||||| || | |||||  |||| |||||||| || | ||||||| ||||  |||||||||||||| || ||||| |    
52780202 aatagccccccacaagatggaggttggtaaatgtttatcaatcccatcttggataaaagaatgttgaaaggtttaggaagcaaagctttagtaaaaaaat 52780103  T
203 ctgcaacttgatctttggatgagactgatagtaacttgaggatg 246  Q
    | || ||||||||||  ||||| ||||  || || |||||||||    
52780102 cagctacttgatcttgagatgaaactgggagcaatttgaggatg 52780059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 93 - 257
Target Start/End: Complemental strand, 24508642 - 24508478
Alignment:
93 ctcatggtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttg 192  Q
    ||||||||||||||||| |||||| |||||||  |||||||| | |||||||||||| |||||||| |||||| |||||| ||| ||||| || |||||     
24508642 ctcatggtgtaatatcctcccacaagttggagattggtagatgtatatcatccccaatttggatagcaaattgctgaatgattgaggaagtaatgcttta 24508543  T
193 gtgaaaaagtctgcaacttgatctttggatgagactgatagtaacttgaggatgttggcttgaag 257  Q
    ||||| || ||| ||||||| ||||| ||||| |||| ||  |||||||| || || ||||||||    
24508542 gtgaagaaatctacaacttggtctttagatgaaactggtaacaacttgagaatatttgcttgaag 24508478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 103 - 242
Target Start/End: Complemental strand, 30039 - 29900
Alignment:
103 aatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagt 202  Q
    ||||||| |||||| ||||| || |||||||||||||||||||||||||||||||  ||||||||||||  ||| ||||| || |||||||| || || |    
30039 aatatcctcccacaagttggcgggtggtagatatctatcatccccaacttggataacaaattgttgaataattgaggaagtaatgctttggtaaagaaat 29940  T
203 ctgcaacttgatctttggatgagactgatagtaacttgag 242  Q
     ||||| ||||||||| ||||| ||||  ||||| |||||    
29939 ttgcaatttgatcttttgatgaaactggcagtaatttgag 29900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 91 - 208
Target Start/End: Original strand, 28154200 - 28154317
Alignment:
91 agctcatggtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctt 190  Q
    ||||||||| |||||| ||||||||| |||||||| ||| | ||||  | |||||||||||||||||||| ||||||||||||||| ||||| |  |  |    
28154200 agctcatggcgtaatagccccccacaagttggaggttggcatatattgaccatccccaacttggatagaagattgttgaatggttgaggaagtagggact 28154299  T
191 tggtgaaaaagtctgcaa 208  Q
    |||||||||| |||||||    
28154300 tggtgaaaaaatctgcaa 28154317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 13133120 - 13133064
Alignment:
99 gtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttgga 155  Q
    |||||||||||||||||| |||||||| |||||||| |||| |||||||||||||||    
13133120 gtgtaatatccccccacaagttggagggtggtagatgtctaacatccccaacttgga 13133064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 94 - 218
Target Start/End: Original strand, 13486811 - 13486935
Alignment:
94 tcatggtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttgg 193  Q
    |||| ||| ||||||| |||||| |||||||| ||||||||||| | |||||||||||||||||||| |   ||||| || ||  |||| |  |  ||||    
13486811 tcattgtgcaatatcctcccacaagttggaggttggtagatatccaacatccccaacttggatagaagaagattgaaaggctgcagaagtagtgacttgg 13486910  T
194 tgaaaaagtctgcaacttgatcttt 218  Q
    |||| ||||||||||||||||||||    
13486911 tgaagaagtctgcaacttgatcttt 13486935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 94 - 157
Target Start/End: Original strand, 31482359 - 31482422
Alignment:
94 tcatggtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggata 157  Q
    |||||||| |||||||||||||| |||||||| ||||| || ||||  || |||||||||||||    
31482359 tcatggtgcaatatccccccacaagttggagggtggtaaatgtctactatacccaacttggata 31482422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 100 - 157
Target Start/End: Original strand, 34977624 - 34977681
Alignment:
100 tgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggata 157  Q
    ||||||||||||| |||  | ||||| ||||||||||| |||| ||||||||||||||    
34977624 tgtaatatccccctacaaataggaggttggtagatatccatcaaccccaacttggata 34977681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 103 - 218
Target Start/End: Original strand, 18482403 - 18482518
Alignment:
103 aatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagt 202  Q
    |||||||||||||| |||||||| |||||||||| || ||||||||||||||||||||     ||||| ||||| |||||||| | ||| || ||||| |    
18482403 aatatccccccacaagttggaggatggtagatatataacatccccaacttggatagaagtagattgaaaggttgaggaagcaatgattttgtaaaaaaat 18482502  T
203 ctgcaacttgatcttt 218  Q
    |||| |||||||||||    
18482503 ctgctacttgatcttt 18482518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 26498401 - 26498345
Alignment:
99 gtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttgga 155  Q
    |||||||||||||||||| |||||||| |||||||| |||| |||||||||||||||    
26498401 gtgtaatatccccccacaagttggagggtggtagatgtctaacatccccaacttgga 26498345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 92 - 218
Target Start/End: Complemental strand, 12996354 - 12996228
Alignment:
92 gctcatggtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagcttt 191  Q
    |||||| |||||||||||| ||||| |||| ||| ||||| ||||| | |||||| |||||||| |  |||||||||||||| || ||||| |  |||||    
12996354 gctcattgtgtaatatcccaccacaagttgaagggtggtatatatcaagcatccctaacttggacaataaattgttgaatggctgaggaagtagtgcttt 12996255  T
192 ggtgaaaaagtctgcaacttgatcttt 218  Q
    ||| || ||||||||||  ||||||||    
12996254 ggtaaagaagtctgcaagctgatcttt 12996228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 8838560 - 8838504
Alignment:
99 gtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttgga 155  Q
    |||||||||||||||||| |||||||| ||||| ||||||| |||||||||||||||    
8838560 gtgtaatatccccccacaagttggagggtggtaaatatctaacatccccaacttgga 8838504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 55312496 - 55312440
Alignment:
99 gtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttgga 155  Q
    |||||||||||||||||| |||||||| |||||||| |||| |||||||||||||||    
55312496 gtgtaatatccccccacaagttggagggtggtagatgtctaacatccccaacttgga 55312440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 103 - 217
Target Start/End: Complemental strand, 12298922 - 12298808
Alignment:
103 aatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagt 202  Q
    |||| ||||||||| | |||||| ||||| || | |||||  |||| |||||||| || | ||||||||||||  |||||||||||||| || ||||| |    
12298922 aatagccccccacaagatggaggttggtaaatttttatcaatcccatcttggataaaagaatgttgaatggtttaggaagcaaagctttagtaaaaaaat 12298823  T
203 ctgcaacttgatctt 217  Q
    | || ||||||||||    
12298822 cagctacttgatctt 12298808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 154
Target Start/End: Complemental strand, 22444233 - 22444197
Alignment:
118 gttggaggctggtagatatctatcatccccaacttgg 154  Q
    |||||||| ||||||||||| ||||||||||||||||    
22444233 gttggagggtggtagatatcaatcatccccaacttgg 22444197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 204
Target Start/End: Original strand, 23369868 - 23369964
Alignment:
108 ccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagtct 204  Q
    ||||||| | |||| ||| ||||| |||||||||||   |||||||||||| ||| || |||| || || ||||| | |||||| ||||||||||||    
23369868 ccccccataagttgaaggatggtaaatatctatcatattcaacttggatagtaaaatgctgaaaggctgaggaagaagagctttagtgaaaaagtct 23369964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0012 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0012
Description:

Target: scaffold0012; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 91 - 182
Target Start/End: Original strand, 176056 - 176147
Alignment:
91 agctcatggtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaag 182  Q
    |||||||||||||||| ||||| |||   |||||| ||||| || |  | |||||||||||||||||||| ||||||||||||||| |||||    
176056 agctcatggtgtaatagcccccaacaaagtggaggttggtatatgttgaccatccccaacttggatagaagattgttgaatggttgaggaag 176147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0329 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0329
Description:

Target: scaffold0329; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 103 - 246
Target Start/End: Complemental strand, 13531 - 13388
Alignment:
103 aatatccccccacatgttggaggctggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaagt 202  Q
    |||| ||||||||| | |||||| ||||| || | |||||  |||| |||||||| || | ||||||||||||  |||||||||||||| || ||||| |    
13531 aatagccccccacaagatggaggttggtaaatgtttatcaatcccatcttggataaaagaatgttgaatggtttaggaagcaaagctttagtaaaaaaat 13432  T
203 ctgcaacttgatctttggatgagactgatagtaacttgaggatg 246  Q
    | || ||||||||||  ||||| ||||  || || |||||||||    
13431 cagctacttgatcttgagatgaaactgggagcaatttgaggatg 13388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 94 - 157
Target Start/End: Original strand, 19799172 - 19799235
Alignment:
94 tcatggtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttggata 157  Q
    |||| ||||||||||||||| || |||||||| ||||| ||||||| || ||||||||||||||    
19799172 tcattgtgtaatatccccccgcaagttggaggttggtatatatctaacaaccccaacttggata 19799235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 128 - 200
Target Start/End: Original strand, 5381943 - 5382015
Alignment:
128 ggtagatatctatcatccccaacttggatagaaaattgttgaatggttgtggaagcaaagctttggtgaaaaa 200  Q
    |||||||||||| ||||||||| |||||||| |||   |||||||| ||||||| ||| | |||||| |||||    
5381943 ggtagatatctaacatccccaatttggatagtaaaaaattgaatggctgtggaaacaaggatttggtaaaaaa 5382015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 14041351 - 14041295
Alignment:
99 gtgtaatatccccccacatgttggaggctggtagatatctatcatccccaacttgga 155  Q
    |||||||||||||||||| | |||||| |||||||| |||| ||  |||||||||||    
14041351 gtgtaatatccccccacaagatggaggttggtagatgtctaacaatcccaacttgga 14041295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University