View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5602_high_6 (Length: 279)
Name: NF5602_high_6
Description: NF5602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5602_high_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 59 - 279
Target Start/End: Complemental strand, 28134319 - 28134099
Alignment:
| Q |
59 |
aagccgacttatacatgctaatctcccaatactttgcatccaacatatccttatcggtcgaatccaacaaatctgcaggattggtagtctccactgtcgc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28134319 |
aagccgacttatacatgctaatctcccaatactttgcatccaacatatccttatcggtcgaatccaacaaatctgcaggattggtagtctccactgtcgc |
28134220 |
T |
 |
| Q |
159 |
agtagtctgaaacgcaccatcatgagccatagctgcaactttactcggcgtacccaagggatgcaaaactccatctatatcttgcataatttttgttata |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28134219 |
agtagtctgaaacgcaccatcatgagccatagctgcaactttactcggcgtacccaagggatgcaaaactccatctatatcttgcataatttttgttata |
28134120 |
T |
 |
| Q |
259 |
aaaccttgcacaaacactgtc |
279 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28134119 |
aaaccttgcacaaacactgtc |
28134099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 61 - 157
Target Start/End: Original strand, 13261811 - 13261907
Alignment:
| Q |
61 |
gccgacttatacatgctaatctcccaatactttgcatccaacatatccttatcggtcgaatccaacaaatctgcaggattggtagtctccactgtcg |
157 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| |||||||||||||||||||| || |||||||||||||| | |||||| || ||||||||||||| |
|
|
| T |
13261811 |
gccgtcttatacatactaatctcccaatacttcgcatccaacatatccttatcagtagaatccaacaaatcagtaggattcgttgtctccactgtcg |
13261907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University