View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5603_low_5 (Length: 345)
Name: NF5603_low_5
Description: NF5603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5603_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 32094801 - 32094572
Alignment:
| Q |
17 |
agaattaacttccatttcaatgtgatcaagcaacatatatcaacctggcttttttcgtgattggaacttcgtgtctgctctttgaggtaaaaatacgcca |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32094801 |
agaattaacttccatttcaaagtgatcaagcaacatatatcaacctggcttttttcgtggttggaacttcgtgtctgctctttgaggtaaaaatacgcct |
32094702 |
T |
|
| Q |
117 |
gtaccgcatgatccatgacttgattctaaaaatatcgctcgcattccgtttccaatgccacggttcccaagttttggcttttggtacaaagatcctgaca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32094701 |
gtaccgcatgatccatgacttgattctaaaaatattgctcgcattccgtttccaatgccacggttcgtaagttttggcttttggtacaaagatcctgaca |
32094602 |
T |
|
| Q |
217 |
tggattttgagtactgcacaagacattttg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32094601 |
tggattttgagtactgcacaagacattttg |
32094572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University