View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5603_low_6 (Length: 319)
Name: NF5603_low_6
Description: NF5603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5603_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 31276378 - 31276658
Alignment:
| Q |
18 |
aaatctacacacttcactgcatcaccatggctaaaaataaaacgagcatcttagcaagtctaagcgaacaccacttgataagttgaccatccacaaaaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31276378 |
aaatctacacacttcactgcatcaccacggctaaaaataaaacgagcatcttagcaagtctaagcgaacaccacttgataagttgaccatccacaaaaac |
31276477 |
T |
 |
| Q |
118 |
aaggctcggatgagtaaattctaactttaaggtcacaccactagaaatttccatctactagacacaattgcataaggttgtacctgaacttgcatgaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31276478 |
aaggctcggatgagtaaattctaactttaaggtcacaccactagaaatgtccatctactagacacaattgcataaggttgtacctgaacttgcatgaaaa |
31276577 |
T |
 |
| Q |
218 |
atcacagtatagcagccactaaaacacaaaagctgataagatactaaggggaccaactctagcacaaaactacaagctacc |
298 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31276578 |
atcacagtacagcagccactaaaacaccaaagctgataagatactaaggggaccaactctagcacaaaactacaagctacc |
31276658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University