View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5604_high_6 (Length: 242)
Name: NF5604_high_6
Description: NF5604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5604_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 44549858 - 44549633
Alignment:
| Q |
1 |
ttggtgattgctcggtctttgaggcggagcttacgggactcatgattgctatggaatttgcagccctttacaacatgtcaagggtgtggctggagagtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44549858 |
ttggtgattgctcggtctttgaggcggagcttacgggactcatgattgctatggaatctgcagccctttacaacatgtcaagggtgtggctggagagtga |
44549759 |
T |
 |
| Q |
101 |
ttcctcaagcgcggttcaggccttcaagaatccatctatcattcctttgcggttacggaatcgttggcacaattgcatgcagcatggtttattcgtcatt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44549758 |
ttcctcaagtgcggttcaggccttcaagaatccatctatcattcctttgcggttacggaatcgttggcacaattgcatgcagcatggtttattcgtcatt |
44549659 |
T |
 |
| Q |
201 |
tgctcccatattttctgtgaaggaaa |
226 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
44549658 |
tgctcccatattttccgtgaaggaaa |
44549633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 87 - 148
Target Start/End: Complemental strand, 6148882 - 6148821
Alignment:
| Q |
87 |
tggctggagagtgattcctcaagcgcggttcaggccttcaagaatccatctatcattccttt |
148 |
Q |
| |
|
||||| || |||| ||| || |||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
6148882 |
tggctagaaagtggttcgtctagcgcggttcaggctttcaagaatccctctatcattccttt |
6148821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University