View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5604_low_4 (Length: 286)
Name: NF5604_low_4
Description: NF5604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5604_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 27 - 270
Target Start/End: Complemental strand, 40709167 - 40708928
Alignment:
| Q |
27 |
tttttgatcacttcctcccctgccatagtttccatgcgtcctttatatatcttgcaagtggctaaatgcttaatcaatttctttattaccgttgccacat |
126 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40709167 |
tttttgatcacttcctccccggccatagtttccatgcgtcctttatatatcttgcaagtggctaaatgcttaatcaatttcttcattaccgttgccacat |
40709068 |
T |
|
| Q |
127 |
tttcatagaaaatcaatgatattaatggccatgaaagcctaagaacaacggttagataaactctataacggtaagcatttaaaccaattgagtaaaggac |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40709067 |
tttcatagaaaatcaatgatattaatggccatgaaagcctaagaacaacggttagataaactctataacggtaagcatttaaaccaattgagtaaaggac |
40708968 |
T |
|
| Q |
227 |
acttgattgattgtgcaacacatgcttgcttatgatcaataatc |
270 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708967 |
acttg----attgtgcaacacatgcttgcttatgatcaataatc |
40708928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University