View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5605-Insertion-1 (Length: 57)
Name: NF5605-Insertion-1
Description: NF5605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5605-Insertion-1 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 2e-20; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 34527913 - 34527962
Alignment:
| Q |
8 |
cttcaggcacctcagtaggtgttgttgaagatgaactcaagttgttttcc |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34527913 |
cttcaggcacctcagtaggtgttgttgaagatgaactcaagttgttttcc |
34527962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 42
Target Start/End: Original strand, 27634001 - 27634028
Alignment:
| Q |
15 |
cacctcagtaggtgttgttgaagatgaa |
42 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27634001 |
cacctcagtaggtgttgttgaagatgaa |
27634028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 42
Target Start/End: Original strand, 34518819 - 34518846
Alignment:
| Q |
15 |
cacctcagtaggtgttgttgaagatgaa |
42 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34518819 |
cacctcagtaggtgttgttgaagatgaa |
34518846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University