View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5605_high_2 (Length: 225)
Name: NF5605_high_2
Description: NF5605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5605_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 207
Target Start/End: Original strand, 36327103 - 36327297
Alignment:
| Q |
14 |
attattcttaattactttgnnnnnnnggcactaacatgatacttaacaaaggaaaaatgaagaatctcaagttaacaagag-aattgtttagtgaaactt |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
36327103 |
attattcttaattactttgaaaaaaaggcactaacatgatacttaacaaaggaaaaatgaagaatttcaagttaacaagaggaattgtttagtgaaactt |
36327202 |
T |
 |
| Q |
113 |
acttcaggctgattaagaagtccagttgcagttgtagggttacattcaggtcccatgggcatgcgcatgttctgttcaaaggcctctttggaagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36327203 |
acttcaggctgattaagaagtccagttgcagttgtagggttacattcaggtcccatgggcatgcgcatgttctgttcaaaggcctctttggaagt |
36327297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 207
Target Start/End: Original strand, 44365257 - 44365357
Alignment:
| Q |
107 |
aaacttacttcaggctgattaagaagtccagttgcagttgtagggttacattcaggtcccatgggcatgcgcatgttctgttcaaaggcctctttggaag |
206 |
Q |
| |
|
||||||||||||||| || ||||| ||||| || ||||| |||||| |||||||||| |||||||| ||||| |||| | |||| | |||||||||| |
|
|
| T |
44365257 |
aaacttacttcaggccgagtaagaggtccaaatgtagttgacgggttagattcaggtccaatgggcatacgcatactctgatgaaagacatctttggaag |
44365356 |
T |
 |
| Q |
207 |
t |
207 |
Q |
| |
|
| |
|
|
| T |
44365357 |
t |
44365357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University