View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5605_low_5 (Length: 219)
Name: NF5605_low_5
Description: NF5605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5605_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 48 - 157
Target Start/End: Original strand, 37015356 - 37015461
Alignment:
| Q |
48 |
ggttatgcatttaggatggaaatattagaacaagatgcccatttctgccgtggttcccaaaacttagatgttgtctctctaagtaagaagtgaaaatatt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37015356 |
ggttatgcatttaggatggaaatattagaacaagatgcccatttccgccctggttcccaaaacttagatgttgtctctc----taagaagtgaaaatatt |
37015451 |
T |
 |
| Q |
148 |
atacacctaa |
157 |
Q |
| |
|
|||||||||| |
|
|
| T |
37015452 |
atacacctaa |
37015461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University