View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5606-Insertion-13 (Length: 255)
Name: NF5606-Insertion-13
Description: NF5606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5606-Insertion-13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 8 - 137
Target Start/End: Original strand, 39154695 - 39154824
Alignment:
| Q |
8 |
gttatatcctagctgggcattccaatcttgggttggaagtgttctggttaggaccaaaggagaaaagggtggcaaggtgttttgtgctgaaatatgtatt |
107 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39154695 |
gttatatgctacctgggcattccaatcttgggttggaagtgttctggttaggaccaaaggagaaaagggtggcaaggtgttttgtgctgaaatatgtatt |
39154794 |
T |
|
| Q |
108 |
atttggggaggattgtgagtatcttccgcc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39154795 |
atttggggaggattgtgagtatcttccgcc |
39154824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 190 - 252
Target Start/End: Original strand, 39154878 - 39154940
Alignment:
| Q |
190 |
aagaaaaagactcttgcaaaaacatgttcatgatatttgaaatttactatatgcaggtctctg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39154878 |
aagaaaaagactcttgcaaaaacatgttcataatatttgaaatttactatatgcaggtctctg |
39154940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 10 - 133
Target Start/End: Original strand, 29125539 - 29125662
Alignment:
| Q |
10 |
tatatcctagctgggcattccaatcttgggttggaagtgttctggttaggaccaaaggagaaaagggtggcaaggtgttttgtgctgaaatatgtattat |
109 |
Q |
| |
|
||||| |||| ||| ||||||||||||||||||| ||| ||||||| |||||||| ||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
29125539 |
tatattctaggtggacattccaatcttgggttgggagttttctggtcaggaccaacggagaaaagggtggccaagtgttttgtgctgaaatatgtattat |
29125638 |
T |
|
| Q |
110 |
ttggggaggattgtgagtatcttc |
133 |
Q |
| |
|
|||| ||||||||| ||||||||| |
|
|
| T |
29125639 |
ttggagaggattgtaagtatcttc |
29125662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 28 - 121
Target Start/End: Complemental strand, 32743432 - 32743337
Alignment:
| Q |
28 |
tccaatcttgggttggaagtgttctggttaggaccaaaggaga--aaagggtggcaaggtgttttgtgctgaaatatgtattatttggggaggatt |
121 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
32743432 |
tccaatcttggattgggagtgttctggtcaggaccaaaggagagaaaagggtggcaatgtgttttgtgctgaaatatgtattatctggagaggatt |
32743337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University