View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5606_high_7 (Length: 380)
Name: NF5606_high_7
Description: NF5606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5606_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 151 - 258
Target Start/End: Original strand, 3341466 - 3341573
Alignment:
| Q |
151 |
tgaagtgaggtgaggaaaagttgaaaataaattagaatatttggatatatgggctggcttctaaaagttgtttgtcatacgggctagattaacggtccgt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3341466 |
tgaagtgaggtgaggaaaagttgaaaataaattagaatatttggatatatgggctggcttctaaaagttgtttgtcatacgggctagattaacggtccgt |
3341565 |
T |
|
| Q |
251 |
ttatcttc |
258 |
Q |
| |
|
|||||||| |
|
|
| T |
3341566 |
ttatcttc |
3341573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 266 - 363
Target Start/End: Original strand, 3342410 - 3342507
Alignment:
| Q |
266 |
aaattgctatttaggcttttaaaattgctctcaaccactccgaagtaatccattccaaatactctccacggaagttaactgtcgctcggtcttgaaca |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
3342410 |
aaattgctatttaggcttttaaaattgctctcaaccactccgaagtaatccattccaaatactctcgacagaagttaactgtcgctcggtcttgaaca |
3342507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University