View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5606_low_11 (Length: 322)
Name: NF5606_low_11
Description: NF5606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5606_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 24 - 322
Target Start/End: Complemental strand, 32726586 - 32726279
Alignment:
| Q |
24 |
ggatgaggaagaagaagaaatggaaacaacaac---------aacaacgacaataaaaacgcaagaagttggtgatgattcaaaagggctaaaactagtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726586 |
ggatgaggaagaagaagaaatggaaacaacaaccacaacaacaacaacggcaataaaaacgcatgaagttggtgatgattcaaaagggctaaaactagtg |
32726487 |
T |
|
| Q |
115 |
cacctattgatggctggcgcggaagccttaaccggttcaaccaaaaaccgtgacttagctcgagtgatattgatccggctcaaggaattagtctcacaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726486 |
cacctattgatggctggcgcggaagccttaaccggttcaaccaaaaaccgtgacttagctcgagtgatattgatccggctcaaggaattagtctcacaac |
32726387 |
T |
|
| Q |
215 |
atgctaacggctccaacatggagagacttgccgctcatttcaccgaagcccttcatggactactagaaggtgctgggggtgcgcataataaccaccatca |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726386 |
atgctaacggctccaacatggagagacttgccgctcatttcaccgaagcccttcatggactactagaaggtgctgggggtgcgcataataaccaccatca |
32726287 |
T |
|
| Q |
315 |
ccacaaca |
322 |
Q |
| |
|
|||||||| |
|
|
| T |
32726286 |
ccacaaca |
32726279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University