View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5606_low_11 (Length: 322)

Name: NF5606_low_11
Description: NF5606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5606_low_11
NF5606_low_11
[»] chr3 (1 HSPs)
chr3 (24-322)||(32726279-32726586)


Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 24 - 322
Target Start/End: Complemental strand, 32726586 - 32726279
Alignment:
24 ggatgaggaagaagaagaaatggaaacaacaac---------aacaacgacaataaaaacgcaagaagttggtgatgattcaaaagggctaaaactagtg 114  Q
    |||||||||||||||||||||||||||||||||         ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||    
32726586 ggatgaggaagaagaagaaatggaaacaacaaccacaacaacaacaacggcaataaaaacgcatgaagttggtgatgattcaaaagggctaaaactagtg 32726487  T
115 cacctattgatggctggcgcggaagccttaaccggttcaaccaaaaaccgtgacttagctcgagtgatattgatccggctcaaggaattagtctcacaac 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32726486 cacctattgatggctggcgcggaagccttaaccggttcaaccaaaaaccgtgacttagctcgagtgatattgatccggctcaaggaattagtctcacaac 32726387  T
215 atgctaacggctccaacatggagagacttgccgctcatttcaccgaagcccttcatggactactagaaggtgctgggggtgcgcataataaccaccatca 314  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32726386 atgctaacggctccaacatggagagacttgccgctcatttcaccgaagcccttcatggactactagaaggtgctgggggtgcgcataataaccaccatca 32726287  T
315 ccacaaca 322  Q
    ||||||||    
32726286 ccacaaca 32726279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University