View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5606_low_15 (Length: 255)
Name: NF5606_low_15
Description: NF5606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5606_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 85 - 238
Target Start/End: Original strand, 19225035 - 19225181
Alignment:
| Q |
85 |
cttaacaaatacaataaggaaacttgttaatattttcgatagttttattaagtctaagcttggtattagcgaagttattagcgaagttggtactgtcata |
184 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19225035 |
cttaacaagtacaataaggatatttgttaatatttttgatagttttatcaagtctaagcttggtatt------------agcgaagttggtactgtcata |
19225122 |
T |
 |
| Q |
185 |
tctcattgtaaatctatattctcttattactatag-----aaacactattgttagattt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
19225123 |
tctcattgtaaatctatattctctcattactatagaaattaaacactattgttagattt |
19225181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 19224804 - 19224853
Alignment:
| Q |
1 |
tgaatgtaaagtttttgttttccctaaaacaaagtgattttttgtgatgt |
50 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19224804 |
tgaatgtaatgtttttgttttccctaaaacaaagtgattttttgtgatgt |
19224853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University