View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5607_low_5 (Length: 262)
Name: NF5607_low_5
Description: NF5607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5607_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 3732034 - 3732288
Alignment:
| Q |
1 |
ttattgaactaaaccttagcatgcagacaataggtaaagaagaactttataattttatcagtaagt-----------tttatcaaccaaaccaaacaaaa |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
3732034 |
ttattgaactaaaccttagcatgcagacaataggtaaagaataactttataattttatcaataagtttttaaaaagttttatcaaccaaaccaaacaaaa |
3732133 |
T |
 |
| Q |
90 |
atttcatatttaaaatttttacgtgcatcgaaatccttctgagtcaattcaccttatgaatcatgtcgactcgaaattcctttcgccatttcagataatt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3732134 |
atttcatatttaaaatttttacgtgcatcgaaatccttctgagccaattcaccttatgaatcatgtcgactcgaaattcctttcgccatttcagataatt |
3732233 |
T |
 |
| Q |
190 |
gagaaacatatctttggatatcgtcatatcaaaatcattcatccgcagaaacctt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3732234 |
gagaaacatatctttggatatcgtcatatcaaaatcattcatccgcagaaacctt |
3732288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University