View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5607_low_7 (Length: 249)
Name: NF5607_low_7
Description: NF5607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5607_low_7 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 4916748 - 4916517
Alignment:
| Q |
18 |
gatacggtcttgatgatcatgagcaacagacctcttagtcccttgtccttgtgtatttttagtttcaacaacgttttgattttgaggtagttgtgtttgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4916748 |
gatacggtcttgatgatcatgagcaacagacctcttagtcccttgtccttgtgtatttttagtttcaacaatgttttgattttgaggtagttgtgtttgt |
4916649 |
T |
 |
| Q |
118 |
gacactgtaacaacttcatgcaaagtgttgttcgttttcaacttcttgttgtctctttccaaatttgtttccaaaggacaagaagagtagctttcaaaaa |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4916648 |
gacactggaacaacttcatgcaaagtgttgttcgttttcaacttcttgttgtctctttccaaatttgtttccaaagtacaagaagagtagctttcaaaaa |
4916549 |
T |
 |
| Q |
218 |
gtaacaatggttgttgttccaaattttcctct |
249 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |
|
|
| T |
4916548 |
gtaacaatggttgttgttgcaaattttcctct |
4916517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 101
Target Start/End: Complemental strand, 4891960 - 4891890
Alignment:
| Q |
31 |
tgatcatgagcaacagacctcttagtcccttgtccttgtgtatttttagtttcaacaacgttttgattttg |
101 |
Q |
| |
|
|||| |||||| |||||||||||||| ||||||||||||| ||| |||||||||||| |||||| ||||| |
|
|
| T |
4891960 |
tgattatgagccacagacctcttagttccttgtccttgtggctttatagtttcaacaatgttttgtttttg |
4891890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University