View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5608_high_21 (Length: 243)
Name: NF5608_high_21
Description: NF5608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5608_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 7887881 - 7888092
Alignment:
| Q |
18 |
tattttagctagcaaacttatcttatcgagtgaatattgatactcaaaattgtagagtttgaataattcgatcttttaattttatggaacgataaatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887881 |
tattttagctagcaaacttatcttatcgagtgaatattgatactcaaaattgtagagtttgaataattcgatcttttaattttatggaacgataaatcaa |
7887980 |
T |
 |
| Q |
118 |
tctttaatttaaatttaaagttttcaatcaatttaaagttggaataggtgagagttcgcacgttgattaggactttcattggtatctattttataattga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887981 |
tctttaatttaaatttaaagttttcaatcaatttaaagttggaataggtgagagttcgcacgttgattaggactttcattggtatctattttataattga |
7888080 |
T |
 |
| Q |
218 |
aaattgattgat |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7888081 |
aaattgattgat |
7888092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University