View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5608_low_22 (Length: 240)

Name: NF5608_low_22
Description: NF5608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5608_low_22
NF5608_low_22
[»] chr4 (1 HSPs)
chr4 (49-223)||(3112780-3112958)


Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 49 - 223
Target Start/End: Original strand, 3112780 - 3112958
Alignment:
49 caaatacagcgaaaccgaatctaaaaccaattaagtttcaagcttttcgtagatttaacagaatttacataaaaattatatc----nnnnnnnattaaag 144  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||           |||||||    
3112780 caaatacagcgaaaccgaatctaaaaccaattaagtttcaagctattcgtagatttaacagaatttacataaaaattatatcttttttcttttattaaag 3112879  T
145 ttacattatgcaaaagataaaacatatagatggcagtaagattgatggatatggatatgcaaaatggtagagaataggt 223  Q
    ||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
3112880 ttacattatgcaaaagaaaaaacaaatagatggcagtaagattaatggatatggatatgcaaaatggtagagaataggt 3112958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University