View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5608_low_9 (Length: 324)
Name: NF5608_low_9
Description: NF5608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5608_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 1331427 - 1331175
Alignment:
| Q |
1 |
cacaccaattgcatcaacattaacgtcattagtaccatcatgagtcgcgtcatttgcatcaacaatgtcgtcatcatcaacaaaattttcaacatgagta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1331427 |
cacaccaattgcatcaacattaacgtcatcagtaccatcatgagtcgcgtcatttgcatcaacaatgtcgtcattatcaacaaaattttcaacatgagta |
1331328 |
T |
 |
| Q |
101 |
ataacaagtgttgcacccgcgcttcaaaagccttggaggatgctatgccgtatgtattctccttgtcaacatatttatgaattgttttctttgaaacata |
200 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1331327 |
ataacaagtg--------gcacttcaaaagccttggaggatgctatgccgtatgcattctccttgtcaacatatttatgaattgttttcttcgaaacata |
1331236 |
T |
 |
| Q |
201 |
tgc-gggnnnnnnnnaccacgatctacattttccacaaccttccgagggattaaccaacga |
260 |
Q |
| |
|
||| || |||| |||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
1331235 |
tgcaggtttttttttaccatgatctacattttccacaatcttccgagggatcaaccaacga |
1331175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University