View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5610-Insertion-7 (Length: 410)
Name: NF5610-Insertion-7
Description: NF5610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5610-Insertion-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 250 - 387
Target Start/End: Complemental strand, 27985949 - 27985812
Alignment:
| Q |
250 |
aagtttgtgtgagacatgagaatgacaatatatccaccagcaccaccttctttgatattgcacaaccaactagtttatttaatgcttgttgataccccag |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27985949 |
aagtttgtgtgagacatgagaatgacaatatatacaccagcaccaccttctttgatattgcacaaccaactagtttatttaatgcttgttggtaccccag |
27985850 |
T |
|
| Q |
350 |
tcccaaatctgaagcaagtgaatgcagacgtgactcat |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27985849 |
tcccaaatctgaagcaagtgaatgcagacgtgactcat |
27985812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 174 - 256
Target Start/End: Complemental strand, 27986063 - 27985981
Alignment:
| Q |
174 |
aaaaggaactggggcaagatcttctagaatttaaagttcgaacttccactgcatattcccaaacactgcacaagagaagtttg |
256 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || |||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
27986063 |
aaaaggaactagggcaagatcttctagaatttgaaattcgaacttccactacacattcccaaacactgcacaagagaagtttg |
27985981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University