View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5611_low_6 (Length: 294)
Name: NF5611_low_6
Description: NF5611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5611_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 2 - 279
Target Start/End: Original strand, 38234790 - 38235067
Alignment:
| Q |
2 |
ggatgtcgaagaaaatatgatagtttattagaaaataatgaaacatatagaactaatttaagtagtattttaagagagtaatatgatggaagtctcttga |
101 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38234790 |
ggatgtcaaataaaatatgatagtttattagaaaataatgaaacatatagaactaatttaagtagtattttaagagagtaatatgatggaagtctcttga |
38234889 |
T |
|
| Q |
102 |
gtcaaggcaaggatatgatagatctgttgctaattgcgttggattaattttgtgggtctagttatcttgaaaaccattgtcgacgtaccaactagtgtag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38234890 |
gtcaaggcaaggatatgatagatctgttgctaattgcgttggattaattttgtgggtctagttatcttgaaaaccattgtcgacgtaccaactagtgtag |
38234989 |
T |
|
| Q |
202 |
cnnnnnnncacttctcttccaactatagtgtcgacatattgtgaagccacaacaactctaaattatttggacaaaatg |
279 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38234990 |
ctttttttcacttctcttccaactatagtgtcgacatattgtgaagccacaacaactctaaattatttggacaaaatg |
38235067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University