View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5612_high_6 (Length: 237)
Name: NF5612_high_6
Description: NF5612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5612_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 12364818 - 12365039
Alignment:
| Q |
1 |
aagattggttttcgaggtatgatttcactgtaaaacatatcaaaggaaatcgaaacataatccctgatttactttccagaccaatgaaacttgtccagat |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12364818 |
aagattggttttcgaggtatgattttactgtaaaacatatcaaagtaaatcaaaacttaatccctgatttactttccagaccaatgaaacctgtccagat |
12364917 |
T |
|
| Q |
101 |
cattaccaacactcacacattttcgttaatcctcatggtaaaaccattaccagctcatggctccatcattatgaatttttctcctgggataaattcttca |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
12364918 |
cattaccaacactcacacatttccgttaatcctcatggtaaaaccattaccagctcatgcctccatcattaagaattttcctcctgggataaatttttca |
12365017 |
T |
|
| Q |
201 |
tgctcactatcccaactcaaag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12365018 |
tgctcactatcccaactcaaag |
12365039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University