View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5612_low_4 (Length: 256)
Name: NF5612_low_4
Description: NF5612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5612_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 21144039 - 21144271
Alignment:
| Q |
1 |
gaggaaaaatatatttactaaaaactttgataaacaagttaaatgtnnnnnnnn-tgtagagaaataagagggagagagttgtttataccagttcaaaat |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
21144039 |
gaggaaaaatatatttactaaaaaatttgataaacaagttaaatgtaaaaaaaaatgtagagaaataagagggagagagttgtttatgctagttcaaaat |
21144138 |
T |
 |
| Q |
100 |
taaacgtggttgttacctttaattcttctctcacaagtggaagatttcacatttgttcacaaatgacataattcacatttgtgtcttctttcttgattga |
199 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144139 |
taaacgtggttgttgcctttaattct---ctcacaagtggaagatttcacatttgttaacaaatgacataattcacatttgtgtcttctttcttgattga |
21144235 |
T |
 |
| Q |
200 |
ttctaatgtgatattctctcaatattctccggcccata |
237 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
21144236 |
ttctaatgtgatat--tctcaatattctccagcccata |
21144271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University